Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G13602-1-5C targets CD122/IL-2RB in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Polyclonal |
Immunogen | CD122/IL-2RB fusion protein Ag3929 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD122/IL-2RB (Polyclonal) |
Calculated Molecular Weight | 551 aa, 61 kDa |
GenBank Accession Number | BC025691 |
Gene Symbol | IL2RB |
Gene ID (NCBI) | 3560 |
ENSEMBL Gene ID | ENSG00000100385 |
RRID | AB_3673884 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGGGTCTGTGACAGCGACCCATATAAGAAA |
Barcode Sequence | GGTCTGTGACAGCGA |
Form | Liquid |
UNIPROT ID | P14784 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
The interleukin 2 receptor, which is involved in T cell-mediated immune responses, is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. The beta subunit (IL2RB, also known as CD122 and p75) is involved in receptor mediated endocytosis and transduces the mitogenic signals of nterleukin 2.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |