MultiPro® 5CFLX Anti-Human CD21 (BU32)

CD21 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65198-1-5C
Clone No.BU32

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

C3DR, CD21, Complement C3d receptor, Complement receptor type 2, CR2, EBV receptor, Epstein Barr virus receptor, SLEB9

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65198-1-5C targets CD21 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen N/A Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD21 (BU32)
Calculated Molecular Weight 1092 aa, 119 kDa
GenBank Accession NumberBC136394
Gene Symbol CD21
Gene ID (NCBI) 1380
ENSEMBL Gene IDENSG00000117322
RRIDAB_3673933
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCCACAATAATGTCAACCCATATAAGAAA
Barcode SequenceCCACAATAATGTCAA
Form Liquid
UNIPROT IDP20023
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD21, also known as complement receptor type 2 (CR2), complement C3d receptor, and Epstein-Barr virus receptor, is a transmembrane protein that contains a small cytoplasmic domain, a transmembrane region and an extracellular domain consisting of 15 tandem short consensus repeat sequences (PMID: 6230668; 2551147). It is expressed on B cells, follicular dendritic cells, thymocytes and a subset of peripheral T cells (PMID: 26119182). CD21 binds complement fragments C3d, C3dg and iC3b and acts as a receptor for the Epstein-Barr virus (PMID: 7753047). On B cells, together with CD19 and CD81, CD21 forms a complex that functions as a co-receptor to the BCR (PMID: 7542009). It is involved in B cells activation and functions.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...