MultiPro® 5CFLX Anti-Human CD45RA (F8-11-13)

CD45RA Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65226-1-5C
Clone No.F8-11-13

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

B220, CD45, CD45R, CD45RA, GP180, L CA, LCA, Leukocyte common antigen, LY5, PTPRC, RPTPC, T200

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65226-1-5C targets CD45RA in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Human T lymphocytes Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD45RA (F8-11-13)
Calculated Molecular Weight 1304 aa, 147 kDa
GenBank Accession NumberBC014239
Gene Symbol CD45
Gene ID (NCBI) 5788
ENSEMBL Gene IDENSG00000081237
RRIDAB_3673937
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTTACTCCTCCAGGTTCCCATATAAGAAA
Barcode SequenceTTACTCCTCCAGGTT
Form Liquid
UNIPROT IDP08575
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD45, also known as protein tyrosine phosphatase, receptor type C, is a type I transmembrane protein expressed on the surface of all haematopoietic cells with the exception of erythrocytes and platelets (PMID: 3489673; 28615666). CD45 is a pan-haematopoietic cell marker and has been shown to be essential for T- and B-cell activation and signalling (PMID: 9429890; 16378097). CD45 exists as multiple isoforms due to alternative splicing of three exons (4, 5, and 6, designated A, B, and C) in the extracellular domain (PMID: 12414720). CD45RA is expressed on naïve T cells, B cells, and monocytes (PMID: 1830500; 14687231).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...