Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G22167-1-5C targets IQGAP1 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Polyclonal |
Immunogen | IQGAP1 fusion protein Ag17821 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human IQGAP1 (Polyclonal) |
Calculated Molecular Weight | 189 kDa |
GenBank Accession Number | BC151834 |
Gene Symbol | IQGAP1 |
Gene ID (NCBI) | 8826 |
ENSEMBL Gene ID | ENSG00000140575 |
RRID | AB_3673894 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGTAGCGTCTATAGCCACCCATATAAGAAA |
Barcode Sequence | TAGCGTCTATAGCCA |
Form | Liquid |
UNIPROT ID | P46940 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
IQGAP1 is a member of a family of scaffolding proteins that interact with signaling and structural molecules. It localizes to sites of cell-cell contact in epithelial cells and regulates distinct cellular processes including cell adhesion, cell migration, extracellular signals through interacting with numerous protein. Multiple studies have shown that IQGAP1 is up-regulated in many human malignancies, such as lung cancer, ovarian cancer, colon cancer, breast cancer, melanoma and HCC. And IQGAP1 plays a critical role in cancer cell invasion.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |