Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G11247-2-5C targets MUM1/IRF4 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Polyclonal |
Immunogen | MUM1/IRF4 fusion protein Ag1762 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human MUM1/IRF4 (Polyclonal) |
Calculated Molecular Weight | 52 kDa |
GenBank Accession Number | BC015752 |
Gene Symbol | IRF4 |
Gene ID (NCBI) | 3662 |
ENSEMBL Gene ID | ENSG00000137265 |
RRID | AB_3673882 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGAGTGCTTCTAGCCGACCCATATAAGAAA |
Barcode Sequence | AGTGCTTCTAGCCGA |
Form | Liquid |
UNIPROT ID | Q15306 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
IRF4 is a member of the IRF family of transcription factors, expressed in most cell types of the immune system. IRF4 is a transcription factor essential for the development of T helper-2 (Th2) cells, IL17-producing Th17 cells, and IL9-producing Th9 cells, as well as dendritic cell (DC). It binds to and activates the ISRE of the MHC class I promoter, and may have a role in ISRE-targeted signal transduction mechanisms specific to lymphoid cells.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |