MultiPro® 5CFLX Anti-Human NFKB2 (6A10E9)

NFKB2 Monoclonal Antibody for Single Cell (Intra)
Cat No. G66920-1-5C
Clone No.6A10E9

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

DNA binding factor KBF2, H2TF1, LYT 10, LYT10, NFKB2, NFKB2,p100, Oncogene Lyt 10, p100

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66920-1-5C targets NFKB2 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen NFKB2 fusion protein Ag28543 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human NFKB2 (6A10E9)
Calculated Molecular Weight 97 kDa
GenBank Accession NumberBC002844
Gene Symbol NFKB2
Gene ID (NCBI) 4791
ENSEMBL Gene IDENSG00000077150
RRIDAB_3673962
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCGAAGTGTGACATCTCCCATATAAGAAA
Barcode SequenceCGAAGTGTGACATCT
Form Liquid
UNIPROT IDQ00653
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

NF-kappa-B is a pleiotropic transcription factor which is present in almost all cell types and is involved in many biological processed such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. NFKB2 appears to have dual functions such as cytoplasmic retention of attached NF-kappa-B proteins by p100 and generation of p52 by a cotranslational processing. The proteasome-mediated process ensures the production of both p52 and p100 and preserves their independent function. P52 binds to the kappa-B consensus sequence 5'-GGRNNYYCC-3', located in the enhancer region of genes involved in immune response and acute phase reactions. P52 and p100 are respectively the minor and major form; the processing of p100 being relatively poor. Isoform p49 is a subunit of the NF-kappa-B protein complex, which stimulates the HIV enhancer in synergy with p65.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...