Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G66508-1-5C targets SP1 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1 |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | SP1 fusion protein Ag16720 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human SP1 (4G3H3) |
Calculated Molecular Weight | 785 aa, 81 kDa |
GenBank Accession Number | BC062539 |
Gene Symbol | SP1 |
Gene ID (NCBI) | 6667 |
ENSEMBL Gene ID | ENSG00000185591 |
RRID | AB_3673956 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGTCATTGCGGATTAGCCCCATATAAGAAA |
Barcode Sequence | TCATTGCGGATTAGC |
Form | Liquid |
UNIPROT ID | P08047 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
The transcription factor Sp1 is a C2H2 zinc-finger protein that is involved in the regulation of a wide variety of genes, including housekeeping genes and tumor-developing genes. It is associated with tumor development, growth, and metastasis [PMID: 16209919]. It regulates the expression of a large number of genes involved in a variety of processes such as cell growth, apoptosis, differentiation and immune responses. Besides, it has a role in modulating the cellular response to DNA damage, recruiting SMARCA4/BRG1 on the c-FOS promoter, regulation of FE65 gene expression [PMID:11371615,16332679]. SP1 has some isoforms with MW ~95-106 kDa and ~60 kDa [PMID:17462816].
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |