Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G60315-1-5C targets c-SRC in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG2b |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | c-SRC fusion protein Ag22306 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human c-SRC (5E10C4) |
Calculated Molecular Weight | 60 kDa |
GenBank Accession Number | BC011566 |
Gene Symbol | SRC |
Gene ID (NCBI) | 6714 |
ENSEMBL Gene ID | ENSG00000197122 |
RRID | AB_3673902 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGGGTACAAGGCTCATCCCCATATAAGAAA |
Barcode Sequence | GGTACAAGGCTCATC |
Form | Liquid |
UNIPROT ID | P12931 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
SRC, also named as SRC1 and p60-Src, belongs to the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. It is a non-receptor protein tyrosine kinase that plays pivotal roles in numerous cellular processes such as proliferation, migration, and transformation. In concert with PTK2B, SRC plays an important role in osteoclastic bone resorption. It promotes energy production in osteoclasts by activating mitochondrial cytochrome C oxidase.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |