Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G30000-0-5C targets Rabbit IgG control in Single Cell (Intra) applications and shows reactivity with NA samples.
| Tested Reactivity | NA |
| Host / Isotype | Rabbit / IgG |
| Class | Oligo Conjugate |
| Type | Polyclonal |
| Immunogen |
N/A Predict reactive species |
| Full Name | MultiPro® 5CFLX Rabbit IgG Isotype Control (Polyclonal) |
| Gene Symbol | |
| Gene ID (NCBI) | |
| RRID | AB_3673897 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGTCCATACGGCCGCACCCCATATAAGAAA |
| Barcode Sequence | TCCATACGGCCGCAC |
| Form | Liquid |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
This product is Normal rabbit IgG (without immunized) which purified with Protein A. Normal Rabbit IgG is an isotype control antibody, which is used to estimate the non-specific binding of target primary antibodies due to Fc receptor binding or other protein-protein interactions. An isotype control antibody should have the same immunoglobulin type and be used at the same concentration as the test antibody.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |



