Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G69007-1-5C targets NeutraKine® IFN Gamma in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Mouse / IgG1 |
| Class | Oligo Conjugate |
| Type | Monoclonal |
| Immunogen |
Product name: HumanKine® recombinant human IFN gamma protein Source: -derived, Tag: Sequence: Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7) |
| Gene Symbol | IFNG |
| Gene ID (NCBI) | 3458 |
| ENSEMBL Gene ID | ENSG00000111537 |
| RRID | AB_3673973 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCGAGAGAATGACTGCCCCATATAAGAAA |
| Barcode Sequence | CGAGAGAATGACTGC |
| Form | Liquid |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Interferon gamma (IFNG) is a soluble cytokine that is the only member of the type II class of interferons. It is secreted by Th1 cells, cytotoxic T cells and NK cells. The cytokine is associated with antiviral, immunoregulatory and anti-tumor properties and is a potent activator of macrophages. It plays crucial roles in pathogen clearance. Aberrant IFNG expression is associated with a number of autoinflammatory and autoimmune diseases. It has been identified in many studies as a biomarker for pleural tuberculosis (TB). Mutations in this gene are associated with aplastic anemia.
This antibody can be used to neutralize the bioactivity of Interferon gamma.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |





