Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G69007-1-5C targets NeutraKine® IFN Gamma in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1 |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | NeutraKine® IFN Gamma fusion protein HZ-1301 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7) |
Gene Symbol | IFNG |
Gene ID (NCBI) | 3458 |
ENSEMBL Gene ID | ENSG00000111537 |
RRID | AB_3673973 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCGAGAGAATGACTGCCCCATATAAGAAA |
Barcode Sequence | CGAGAGAATGACTGC |
Form | Liquid |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Interferon gamma (IFNG) is a soluble cytokine that is the only member of the type II class of interferons. It is secreted by Th1 cells, cytotoxic T cells and NK cells. The cytokine is associated with antiviral, immunoregulatory and anti-tumor properties and is a potent activator of macrophages. It plays crucial roles in pathogen clearance. Aberrant IFNG expression is associated with a number of autoinflammatory and autoimmune diseases. It has been identified in many studies as a biomarker for pleural tuberculosis (TB). Mutations in this gene are associated with aplastic anemia.
This antibody can be used to neutralize the bioactivity of Interferon gamma.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |