MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7)

NeutraKine® IFN Gamma Monoclonal Antibody for Single Cell (Intra)

Cat No. G69007-1-5C
Clone No.1E10G7

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

IFG, IFI, IFN gamma, IFN γ, IFNG, IFN-gamma, IFNγ, IFN-γ, Immune interferon, Interferon gamma, interferon, gamma, NeutraKine® IFN Gamma

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G69007-1-5C targets NeutraKine® IFN Gamma in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen NeutraKine® IFN Gamma fusion protein HZ-1301 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7)
Gene Symbol IFNG
Gene ID (NCBI) 3458
ENSEMBL Gene IDENSG00000111537
RRIDAB_3673973
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCGAGAGAATGACTGCCCCATATAAGAAA
Barcode SequenceCGAGAGAATGACTGC
Form Liquid
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Interferon gamma (IFNG) is a soluble cytokine that is the only member of the type II class of interferons. It is secreted by Th1 cells, cytotoxic T cells and NK cells. The cytokine is associated with antiviral, immunoregulatory and anti-tumor properties and is a potent activator of macrophages. It plays crucial roles in pathogen clearance. Aberrant IFNG expression is associated with a number of autoinflammatory and autoimmune diseases. It has been identified in many studies as a biomarker for pleural tuberculosis (TB). Mutations in this gene are associated with aplastic anemia.

This antibody can be used to neutralize the bioactivity of Interferon gamma.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...