MultiPro® 5CFLX Anti-Human CD107b/LAMP2 (H4B4)

• 

  Single Cell Sequencing experiment G65053-1-5C on Resting PBMC

  G65053-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65053-1-5C on PBMC treated with 4hr LPS + TI

  G65053-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD107b / LAMP2 Monoclonal Antibody for Single Cell (Intra)

Cat No. G65053-1-5C

Clone No.H4B4

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD107b, Cell and organelle markers, LAMP 2, LAMP2, LAMPB, LGP110, Lysosome Marker

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65053-1-5C targets CD107b / LAMP2 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  Human adherent peripheral blood cells

• Full Name: MultiPro® 5CFLX Anti-Human CD107b/LAMP2 (H4B4)
• Calculated Molecular Weight: 45 kDa
• GenBank Accession Number: BC002965
• Gene Symbol: LAMP2
• Gene ID (NCBI): 3920
• ENSEMBL Gene ID: ENSG00000005893
• RRID: AB_3673905
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCGTTCTCCATCTTGCCCATATAAGAAA
• Barcode Sequence: CCGTTCTCCATCTTG
• Form: Liquid
• UNIPROT ID: P13473
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

LAMP2 (CD107b) is a Lysosomal membrane glycoprotein. LAMP2 is extensively glycosylated with asparagine-linked oligosaccharides which protect it from intracellular proteolysis (PMID: 10521503). Although LAMP-2 is localized primarily in the endosome-lysosomal membrane of cells, it is also found on the plasma membrane under certain circumstances, e.g., after platelet activation, during granulocytic differentiation and activation, and in some tumor cells (PMID: 12221139). LAMP is involved in lysosomal stability and autophagy (PMID: 12221139). This glycoprotein provides selectins with carbohydrate ligands. LAMP2 may plays a role in tumor cell metastasis (PMID 9426697).