Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Positive Single Cell detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
SINGLE CELL | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65194-1-5C targets CD11a in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen |
fusion protein Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD11a (TS2/4) |
Calculated Molecular Weight | 129 kDa |
GenBank Accession Number | BC008777 |
Gene Symbol | CD11a |
Gene ID (NCBI) | 3683 |
ENSEMBL Gene ID | ENSG00000005844 |
RRID | AB_3673931 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCCACTAGATGCTTGGCCCATATAAGAAA |
Barcode Sequence | CCACTAGATGCTTGG |
Form | Liquid |
UNIPROT ID | P20701 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD11a, also known as integrin αL or LFA-1α, is a 170-180 kDa transmembrane glycoprotein that forms a heterodimer with CD18 (PMID: 7027264; 1672643). CD11a/CD18 (LFA-1) is expressed by all leukocytes and mediates cell adhesion through interactions with its ligands, intercellular adhesion molecule 1 (ICAM-1), ICAM-2, and ICAM-3 (PMID: 7479767). CD11a/CD18 also functions in lymphocyte costimulatory signaling (PMID: 1972160).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |