MultiPro® 5CFLX Anti-Human CD11b (ICRF44)

CD11b Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65116-1-5C
Clone No.ICRF44

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD11B, CR 3 alpha chain, CR3A, Integrin alpha M, ITGAM, MAC 1, MAC1A, MO1A, Neutrophil adherence receptor, SLEB6

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration:  10 μg
10 μg

$325/ 10 μg

In stock at manufacturing site. Delivery in 3-4 weeks.

Freight/Packing: $40.00

Quantity

Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65116-1-5C targets CD11b in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Rheumatoid synovial cells and human monocytes Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD11b (ICRF44)
Calculated Molecular Weight 1152 aa, 127 kDa
GenBank Accession NumberBC096346
Gene Symbol CD11b
Gene ID (NCBI) 3684
ENSEMBL Gene IDENSG00000169896
RRIDAB_3673917
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCCAGTCAATAGCTATCCCATATAAGAAA
Barcode SequenceCCAGTCAATAGCTAT
Form Liquid
UNIPROT IDP11215
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Integrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11b, also known as Integrin alpha M or CR3A, belongs to the integrin alpha chain family. CD11b forms an α/β heterodimer with CD18 (integrin β2). CD11b/CD18 is implicated in various adhesive interactions of monocytes, macrophages and granulocytes as well as in mediating the uptake of complement-coated particles and pathogens (PMID: 9558116; 20008295). CD11b/CD18 is a receptor for the complement protein fragment iC3b, and is also a receptor for fibrinogen, factor X and ICAM1 (PMID: 2971974; 15485828).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...