This product is currently not available for sale.


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G60253-1-5C targets CD14 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen CD14 fusion protein Ag10693 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD14 (2C1D9)
Calculated Molecular Weight 375 aa, 40 kDa
GenBank Accession NumberBC010507
Gene Symbol CD14
Gene ID (NCBI) 929
ENSEMBL Gene IDENSG00000170458
RRIDAB_3673900
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGATCGTCTGTTGCGCGCCCATATAAGAAA
Barcode SequenceATCGTCTGTTGCGCG
Form Liquid
UNIPROT IDP08571
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD14 is a 50-55 kDa glycosylphosphatidylinositol-anchored glycoprotein preferentially expressed on monocytes and macrophages, and at lower levels on granulocytes (PMID: 3385210; 2462937; 7685797). CD14 can also exist as a soluble protein. CD14 acts as a co-receptor for bacterial liposaccharides (LPS) (PMID: 1698311). It plays a major role in the inflammatory response of monocytes to LPS.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...