MultiPro® 5CFLX Anti-Human CD18 (TS1/18)

CD18 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65190-1-5C
Clone No.TS1/18

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD18, Integrin beta 2, ITGB2, LAD, LCAMB, LFA 1, MAC 1, MF17, MFI7

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration:  10 μg
10 μg

$325/ 10 μg

Freight/Packing: $40.00

Quantity

Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65190-1-5C targets CD18 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Human Beta 2 Integrin Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD18 (TS1/18)
Calculated Molecular Weight 85 kDa
GenBank Accession NumberBC005861
Gene Symbol CD18
Gene ID (NCBI) 3689
ENSEMBL Gene IDENSG00000160255
RRIDAB_3673928
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCGTGGTTGGAAGCACCCCATATAAGAAA
Barcode SequenceCGTGGTTGGAAGCAC
Form Liquid
UNIPROT IDP05107
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD18, also known as integrin beta-2, is a transmembrane protein that forms heterodimers with CD11a, CD11b, CD11c, CD11d (PMID: 1968349). CD11a/CD18 (LFA-1) is expressed by all leukocytes, while CD11b/CD18 (Mac-1) and CD11c/CD18 (p150,95) are normally restricted to expression on monocytes, macrophages, polymorphonuclear lymphocytes (PMNs), and natural killer cells (PMID: 1968349; 3109455; 10946284). CD18 plays an important role in mediating cell adhesion during immune response and defects of CD18 cause leukocyte adhesion deficiency (PMID: 3594570).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...