MultiPro® 5CFLX Anti-Human CD28 (CD28.2)

CD28 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65099-1-5C
Clone No.CD28.2

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

CD28, CD28 molecule, Tp44

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65099-1-5C targets CD28 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen N/A Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD28 (CD28.2)
Calculated Molecular Weight 220 aa, 25 kDa
GenBank Accession NumberBC093698
Gene Symbol CD28
Gene ID (NCBI) 940
ENSEMBL Gene IDENSG00000178562
RRIDAB_3673912
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGGTTATCGCAACGTTACCCATATAAGAAA
Barcode SequenceGTTATCGCAACGTTA
FormLiquid
UNIPROT IDP10747
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD28 (T-cell-specific surface glycoprotein CD28), also known as T44 and Tp44, is a 44 kD disulfide-linked homodimeric type I glycoprotein (PMID: 2162180). It is a member of the immunoglobulin superfamily and is expressed on most T lineage cells, NK cell subsets, and plasma cells (PMID: 2162180, 8386518). CD28 may affect in vivo immune responses by functioning both as a cell adhesion molecule linking B and T lymphocytes and as the surface component of a novel signal transduction pathway (PMID: 2162180, 3021470). CD28 binds both CD80 and CD86 with a highly conserved motif MYPPY in the CDR3-like loop (PMID: 15696168, 7964482). CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death (PMID: 1348520).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...