Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
| Positive Single Cell detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| SINGLE CELL | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G65099-1-5C targets CD28 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Mouse / IgG1, kappa |
| Class | Oligo Conjugate |
| Type | Monoclonal |
| Immunogen |
N/A Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human CD28 (CD28.2) |
| Calculated Molecular Weight | 220 aa, 25 kDa |
| GenBank Accession Number | BC093698 |
| Gene Symbol | CD28 |
| Gene ID (NCBI) | 940 |
| ENSEMBL Gene ID | ENSG00000178562 |
| RRID | AB_3673912 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGGTTATCGCAACGTTACCCATATAAGAAA |
| Barcode Sequence | GTTATCGCAACGTTA |
| Form | Liquid |
| UNIPROT ID | P10747 |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD28 (T-cell-specific surface glycoprotein CD28), also known as T44 and Tp44, is a 44 kD disulfide-linked homodimeric type I glycoprotein (PMID: 2162180). It is a member of the immunoglobulin superfamily and is expressed on most T lineage cells, NK cell subsets, and plasma cells (PMID: 2162180, 8386518). CD28 may affect in vivo immune responses by functioning both as a cell adhesion molecule linking B and T lymphocytes and as the surface component of a novel signal transduction pathway (PMID: 2162180, 3021470). CD28 binds both CD80 and CD86 with a highly conserved motif MYPPY in the CDR3-like loop (PMID: 15696168, 7964482). CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death (PMID: 1348520).
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |







