MultiPro® 5CFLX Anti-Human CD4 (RPA-T4)

• 

  Single Cell Sequencing experiment G65143-1-5C on Resting PBMC

  G65143-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65143-1-5C on PBMC treated with 4hr LPS + TI

  G65143-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65143-1-5C on Resting PBMC

  G65143-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65143-1-5C on PBMC treated with 4hr LPS + TI

  G65143-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD4 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65143-1-5C

Clone No.RPA-T4

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD4, CD4 molecule, CD4mut

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65143-1-5C targets CD4 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  N/A

• Full Name: MultiPro® 5CFLX Anti-Human CD4 (RPA-T4)
• Calculated Molecular Weight: 55 kDa
• GenBank Accession Number: BC025782
• Gene Symbol: CD4
• Gene ID (NCBI): 920
• ENSEMBL Gene ID: ENSG00000010610
• RRID: AB_3673919
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTCTTACAACGCAGTCCCATATAAGAAA
• Barcode Sequence: GTCTTACAACGCAGT
• Form: Liquid
• UNIPROT ID: P01730
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD4 is a 55-kDa transmembrane glycoprotein expressed on T helper cells, majority of thymocytes, monocytes, macrophages, and dendritic cells (PMID: 9304802; 12213222). CD4 is an accessory protein for MHC class-II antigen/T-cell receptor interaction. It plays an important role in T helper cell development and activation (PMID: 9539765; 3112582). CD4 serves as a receptor for the human immunodeficiency virus (HIV) (PMID: 9304802).