Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. | 
Recommended dilution
| Application | Dilution | 
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test | 
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G65067-1-5C targets CD56 in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human | 
| Host / Isotype | Mouse / IgG2a | 
| Class | Oligo Conjugate | 
| Type | Monoclonal | 
| Immunogen | Acute myelogenous leukemia cell line KG-1Predict reactive species | 
| Full Name | MultiPro® 5CFLX Anti-Human CD56 (MEM-188) | 
| GenBank Accession Number | BC014205 | 
| Gene Symbol | NCAM1 | 
| Gene ID (NCBI) | 4684 | 
| ENSEMBL Gene ID | ENSG00000149294 | 
| RRID | AB_3673908 | 
| Conjugate | 5CFLX | 
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCTATCACTTGTCGTGCCCATATAAGAAA | 
| Barcode Sequence | CTATCACTTGTCGTG | 
| Form | Liquid | 
| UNIPROT ID | P13591 | 
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. | 
| Storage Conditions | 2-8°C Stable for one year after shipment. | 
Background Information
Neural cell adhesion molecule 1 (NCAM1, also known as CD56) is a cell adhesion glycoprotein of the immunoglobulin (Ig) superfamily. It is a multifunction protein involved in synaptic plasticity, neurodevelopment, and neurogenesis. NCAM1 is expressed on human neurons, glial cells, skeletal muscle cells, NK cells and a subset of T cells, and the expression is observed in a wide variety of human tumors, including myeloma, myeloid leukemia, neuroendocrine tumors, Wilms' tumor, neuroblastoma, and NK/T cell lymphomas.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol | 
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol | 




