MultiPro® 5CFLX Anti-Human CD86 (BU63)

• 

  Single Cell Sequencing experiment G65165-1-5C on PBMC treated with 4hr LPS + TI

  G65165-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65165-1-5C on Resting PBMC

  G65165-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65165-1-5C on PBMC treated with 4hr LPS + TI

  G65165-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD86 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65165-1-5C

Clone No.BU63

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

Activation B7 2 antigen, B7 2, B70, BU63, CD28LG2, CD86, CD86 molecule, CTLA 4 counter receptor B7.2, FUN 1, LAB72

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65165-1-5C targets CD86 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  B-lymphoblastoid cell line ARH 77

• Full Name: MultiPro® 5CFLX Anti-Human CD86 (BU63)
• Calculated Molecular Weight: 329 aa, 38 kDa
• GenBank Accession Number: BC040261
• Gene Symbol: CD86
• Gene ID (NCBI): 942
• ENSEMBL Gene ID: ENSG00000114013
• RRID: AB_3673923
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCGAGTTGCGAAGTTCCCATATAAGAAA
• Barcode Sequence: CCGAGTTGCGAAGTT
• Form: Liquid
• UNIPROT ID: P42081
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD86 (also known as B7.2) is a costimulatory molecule belonging to the immunoglobulin superfamily. Primarily expressed on antigen-presenting cells (APCs), including B cells, dendritic cells, and macrophages, CD86 is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of CD86 with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of CD86 with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response.