Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. | 
| Positive Single Cell detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. | 
Recommended dilution
| Application | Dilution | 
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test | 
| SINGLE CELL | <0.5ug/test | 
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G65165-1-5C targets CD86 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.
| Tested Reactivity | Human | 
| Host / Isotype | Mouse / IgG1, kappa | 
| Class | Oligo Conjugate | 
| Type | Monoclonal | 
| Immunogen | 
                                             B-lymphoblastoid cell line ARH 77 Predict reactive species | 
                                    
| Full Name | MultiPro® 5CFLX Anti-Human CD86 (BU63) | 
| Calculated Molecular Weight | 329 aa, 38 kDa | 
| GenBank Accession Number | BC040261 | 
| Gene Symbol | CD86 | 
| Gene ID (NCBI) | 942 | 
| ENSEMBL Gene ID | ENSG00000114013 | 
| RRID | AB_3673923 | 
| Conjugate | 5CFLX | 
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCCGAGTTGCGAAGTTCCCATATAAGAAA | 
| Barcode Sequence | CCGAGTTGCGAAGTT | 
| Form | Liquid | 
| UNIPROT ID | P42081 | 
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. | 
| Storage Conditions | 2-8°C Stable for one year after shipment. | 
Background Information
CD86 (also known as B7.2) is a costimulatory molecule belonging to the immunoglobulin superfamily. Primarily expressed on antigen-presenting cells (APCs), including B cells, dendritic cells, and macrophages, CD86 is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of CD86 with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of CD86 with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol | 
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol | 





