MultiPro® 5CFLX Anti-Human Cyclin D3 (1F2C6)

Cyclin D3 Monoclonal Antibody for Single Cell (Intra)
Cat No. G66357-1-5C
Clone No.1F2C6

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

CCND3, Cyclin D3, G1/S specific cyclin D3

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66357-1-5C targets Cyclin D3 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen Cyclin D3 fusion protein Ag22825 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human Cyclin D3 (1F2C6)
Calculated Molecular Weight 33 kDa
GenBank Accession NumberBC011616
Gene Symbol Cyclin D3
Gene ID (NCBI) 896
ENSEMBL Gene IDENSG00000112576
RRIDAB_3673948
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCCTAAGTTCTAACAGCCCATATAAGAAA
Barcode SequenceCCTAAGTTCTAACAG
Form Liquid
UNIPROT IDP30281
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Cyclin D3 belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activitiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...