Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G66357-1-5C targets Cyclin D3 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1 |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | Cyclin D3 fusion protein Ag22825 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human Cyclin D3 (1F2C6) |
Calculated Molecular Weight | 33 kDa |
GenBank Accession Number | BC011616 |
Gene Symbol | Cyclin D3 |
Gene ID (NCBI) | 896 |
ENSEMBL Gene ID | ENSG00000112576 |
RRID | AB_3673948 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCCTAAGTTCTAACAGCCCATATAAGAAA |
Barcode Sequence | CCTAAGTTCTAACAG |
Form | Liquid |
UNIPROT ID | P30281 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Cyclin D3 belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activitiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |