Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G69001-1-5C targets NeutraKine® IL-6 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1 |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen |
Product name: HumanKine® recombinant human IL-6 protein Source: -derived, Tag: Sequence: Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human IL-6 (4G3E6) |
Gene Symbol | IL6 |
Gene ID (NCBI) | 3569 |
ENSEMBL Gene ID | ENSG00000136244 |
RRID | AB_3673972 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGACCGCACAGCGAATTCCCATATAAGAAA |
Barcode Sequence | ACCGCACAGCGAATT |
Form | Liquid |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. IL-6 plays an essential role in the final differentiation of B-cells into Ig-secreting cells involved in lymphocyte and monocyte differentiation. It induces myeloma and plasmacytoma growth and induces nerve cells differentiation Acts on B-cells, T-cells, hepatocytes, hematopoietic progenitor cells and cells of the CNS. IL-6 is also considered a myokine, a cytokine produced from muscle, and is elevated in response to muscle contraction. IL-6 has been shown to interact with interleukin-6 receptor and glycoprotein 130. Additionally, IL-6 is involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.
This antibody can be used to neutralize the bioactivity of IL-6.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |