MultiPro® 5CFLX Anti-Human LASP1 (1G4B6)

LASP1 Monoclonal Antibody for Single Cell (Intra)
Cat No. G68080-1-5C
Clone No.1G4B6

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Lasp 1, LASP1, LIM and SH3 domain protein 1, LIM and SH3 protein 1, MLN 50, MLN50

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration:  10 μg
10 μg

$325/ 10 μg

In stock at manufacturing site. Delivery in 3-4 weeks.

Freight/Packing: $40.00

Quantity

Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G68080-1-5C targets LASP1 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen LASP1 fusion protein Ag18101 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human LASP1 (1G4B6)
Calculated Molecular Weight 30 kDa
GenBank Accession NumberBC012460
Gene Symbol LASP1
Gene ID (NCBI) 3927
ENSEMBL Gene IDENSG00000002834
RRIDAB_3673971
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGACAATACACCAGCACCCCATATAAGAAA
Barcode SequenceACAATACACCAGCAC
Form Liquid
UNIPROT IDQ14847
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

LASP1(LIM and SH3 protein 1), also known as MLN50, is a 261 amino acid protein that localizes to both the cytoplasm and the cytoskeleton(PMID: 7589475). LASP1 consists of an N-terminal LIM-domain with two zinc finger motifs, followed by two central actin-binding nebulin repeats, flanked by a linker region and a C-terminal SH3 domain (PMID: 17177073, 9848085). LASP-1 interacts with F-Actin and plays an important role in the regulation of Actin-associated cytoskeletal organization. Agonist-dependent changes in LASP1 phosphorylation may regulate Actin-related ion transport activities in epithelial cells (PMID: 15465019,12571245). Overexpression of LASP-1 is associated with breast cancer, and plays a role in tumor transformation and metastasis (PMID: 17956604).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...