Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G66659-1-5C targets POU2AF1 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1 |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | POU2AF1 fusion protein Ag23613 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human POU2AF1 (3C5A7) |
Calculated Molecular Weight | 256 aa, 27 kDa |
GenBank Accession Number | BC032549 |
Gene Symbol | POU2AF1 |
Gene ID (NCBI) | 5450 |
ENSEMBL Gene ID | ENSG00000110777 |
RRID | AB_3673958 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGGGTATCCGCAAGCGTCCCATATAAGAAA |
Barcode Sequence | GGTATCCGCAAGCGT |
Form | Liquid |
UNIPROT ID | Q16633 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
POU2AF1, also named as BOB-1 or OCA-B, is a 256 amino acid protein, which belongs to the POU2AF1 family. POU2AF1 is expressed in B-cell specific. POU2AF1 as a transcriptional coactivator that specifically associates with either OCT1 or OCT2. It boosts the OCT1 mediated promoter activity and to a lesser extent, that of OCT2. It has no intrinsic DNA-binding activity. It recognizes the POU domains of OCT1 and OCT2. It is essential for the response of B-cells to antigens and required for the formation of germinal centers.The predicted size of this protein is 27 kDa. Studies have reported that the protein has a multi-band size of 34-35 kDa through siRNA interference experiments (PMID: 17621271). This result is the same as our experiments.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |