MultiPro® 5CFLX Anti-Human Phospho-MEK1 (Ser298) (3F10G10)

• 

  Single Cell Sequencing experiment G68047-1-5C on Resting PBMC

  G68047-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G68047-1-5C on PBMC treated with 4hr LPS + TI

  G68047-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

Phospho-MEK1 (Ser298) Monoclonal Antibody for Single Cell (Intra)

Cat No. G68047-1-5C

Clone No.3F10G10

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

ERK activator kinase 1, MAP kinase kinase 1, MAP2K1, MAPK/ERK kinase 1, MAPKK 1, MAPKK1, MEK 1, MEK1, MKK1, Phospho-MEK1 (Ser298), PRKMK1

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G68047-1-5C targets Phospho-MEK1 (Ser298) in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen: Peptide
• Full Name: MultiPro® 5CFLX Anti-Human Phospho-MEK1 (Ser298) (3F10G10)
• Calculated Molecular Weight: 43 kDa
• GenBank Accession Number: BC139729
• Gene Symbol: MEK1
• Gene ID (NCBI): 5604
• ENSEMBL Gene ID: ENSG00000169032
• RRID: AB_3673970
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGCTCTAATAGTCGGCCCATATAAGAAA
• Barcode Sequence: TGCTCTAATAGTCGG
• Form: Liquid
• UNIPROT ID: Q02750
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

MAP2K1 encodes MAPK1, also known as MEK1. MEK1 variants can enhance MEK1 expression and ERK1 phosphorylation that together lead to continuous activation of MEK/ERK signaling pathway. MEK1 bind directly to ERK2 through a region in the N terminus of MEK. In addition, a proline-rich (PR) regulatory sequence in MEK is also involved in MEK-ERK association and signal propagation. The coupling between MEK1 and ERK2 is enhanced through phosphorylation on S298 in the MEK1 PR region, whereas phosphorylation on MEK1 T292 releases the complex. MEK1 T292 is a substrate of ERK2, but the site is also phosphorylated at a basal level when ERK2 is inhibited, suggesting several regulators of this site . Although the S298 site in MEK2 has been conserved, it lacks the T292 phosphorylation site, and it is not a substrate of PAK1. (PMID: 31972311, PMID: 17928366, PMID: 22177953)