Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G14464-1-5C targets TCF7 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Polyclonal |
Immunogen | TCF7 fusion protein Ag5792 Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human TCF7 (Polyclonal) |
Calculated Molecular Weight | 42 kDa |
GenBank Accession Number | BC048769 |
Gene Symbol | TCF1/TCF7 |
Gene ID (NCBI) | 6932 |
ENSEMBL Gene ID | ENSG00000081059 |
RRID | AB_3673888 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCGCCTATAGAGACGCCCCATATAAGAAA |
Barcode Sequence | CGCCTATAGAGACGC |
Form | Liquid |
UNIPROT ID | P36402 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
TCF7, also known as TCF1, belongs to the TCF/LEF family. TCF7 is part of the Wnt signaling pathway and plays an important role in the differentiation and self-renewal of memory T cells. It has been found that TCF7 is necessary to revive T cells in response to PD-1 blockade against viral infection or cancer. TCF7 is mainly expressed in T-cells and is also detected in proliferating intestinal epithelial cells and in the basal epithelial cells of mammary gland epithelium. TCF7 has 16 isoforms with the molecular mass of 28-54 kDa (PMID: 34044317).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |