MultiPro® 5CFLX Anti-Human Vimentin (3H9D1)

Vimentin Monoclonal Antibody for Single Cell (Intra)
Cat No. G60330-1-5C
Clone No.3H9D1

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

VIM, Vimentin

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration:  10 μg
10 μg

$325/ 10 μg

In stock at manufacturing site. Delivery in 3-4 weeks.

Freight/Packing: $40.00

Quantity

Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G60330-1-5C targets Vimentin in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen Vimentin fusion protein Ag0489 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human Vimentin (3H9D1)
Calculated Molecular Weight 466 aa, 54 kDa
GenBank Accession NumberBC000163
Gene Symbol VIM
Gene ID (NCBI) 7431
ENSEMBL Gene IDENSG00000026025
RRIDAB_3673903
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGACATGCCTAGCTCCGCCCATATAAGAAA
Barcode SequenceACATGCCTAGCTCCG
Form Liquid
UNIPROT IDP08670
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Vimentin, also named as VIM, belongs to the intermediate filament family. Vimentin is class-III intermediate filaments found in various non-epithelial cells, especially mesenchymal cells. Vimentin is important for stabilizing the architecture of the cytoplasm. Monocyte-derived macrophages secrete vimentin into the extracellular space in vitro. Secretion of vimentin was enhanced by the proinflammatory cytokine tumor necrosis factor-alpha (TNFA; 191160) and inhibited by the antiinflammatory cytokine IL10 (124092), suggesting that vimentin is involved in the immune response. Vimentin has specialized functions that contribute to specific dynamic cellular processes. As a phosphoprotein, 55-60 kDa of vimentin proteins can be observed due to the different phosphorylation level.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...