MultiPro® 5CFLX Anti-Human Beta-2-Microglobulin (Polyclonal)

Beta-2-Microglobulin Polyclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G13511-1-5C

Host / Isotype

Rabbit / IgG

Reactivity

Human

B2M, Beta-2-microglobulin, HDCMA22P

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration:  10 μg
10 μg

$325/ 10 μg

In stock at manufacturing site. Delivery in 3-4 weeks.

Freight/Packing: $40.00

Quantity

Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G13511-1-5C targets Beta-2-Microglobulin in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Rabbit / IgG
Class Oligo Conjugate
Type Polyclonal
Immunogen Beta-2-Microglobulin fusion protein Ag4433 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human Beta-2-Microglobulin (Polyclonal)
Calculated Molecular Weight 119 aa, 14 kDa
GenBank Accession NumberBC032589
Gene Symbol B2M
Gene ID (NCBI) 567
ENSEMBL Gene IDENSG00000166710
RRIDAB_3673883
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGACATATGCGATAGAACCCATATAAGAAA
Barcode SequenceACATATGCGATAGAA
Form Liquid
UNIPROT IDP61769
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Beta-2-microglobulin (B2M) is a component of MHC class I molecules, which are present on the surface of nearly all nucleated cells. It can be found in body fluids under physiologic conditions as a result of shedding from cell surfaces or intracellular release. B2M has various biological functions, including antigen presentation. Investigations reveal that increased synthesis and release of B2M are present in several malignant diseases.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...