MultiPro® 5CFLX Anti-Human CD11b (ICRF44)

• 

  Single Cell Sequencing experiment G65116-1-5C on Resting PBMC

  G65116-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65116-1-5C on PBMC treated with 4hr LPS + TI

  G65116-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65116-1-5C on Resting PBMC

  G65116-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD11b Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65116-1-5C

Clone No.ICRF44

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD11B, CR 3 alpha chain, CR3A, Integrin alpha M, ITGAM, MAC 1, MAC1A, MO1A, Neutrophil adherence receptor, SLEB6

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65116-1-5C targets CD11b in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  Rheumatoid synovial cells and human monocytes

• Full Name: MultiPro® 5CFLX Anti-Human CD11b (ICRF44)
• Calculated Molecular Weight: 1152 aa, 127 kDa
• GenBank Accession Number: BC096346
• Gene Symbol: CD11b
• Gene ID (NCBI): 3684
• ENSEMBL Gene ID: ENSG00000169896
• RRID: AB_3673917
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCAGTCAATAGCTATCCCATATAAGAAA
• Barcode Sequence: CCAGTCAATAGCTAT
• Form: Liquid
• UNIPROT ID: P11215
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

Integrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11b, also known as Integrin alpha M or CR3A, belongs to the integrin alpha chain family. CD11b forms an α/β heterodimer with CD18 (integrin β2). CD11b/CD18 is implicated in various adhesive interactions of monocytes, macrophages and granulocytes as well as in mediating the uptake of complement-coated particles and pathogens (PMID: 9558116; 20008295). CD11b/CD18 is a receptor for the complement protein fragment iC3b, and is also a receptor for fibrinogen, factor X and ICAM1 (PMID: 2971974; 15485828).