Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65247-1-5C targets CD226 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | Human NK Cells Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD226 (11A8) |
Calculated Molecular Weight | 336 aa, 39 kDa |
GenBank Accession Number | BC074787 |
Gene Symbol | CD226 |
Gene ID (NCBI) | 10666 |
ENSEMBL Gene ID | ENSG00000150637 |
RRID | AB_3673938 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGATTACTTATACGGAACCCATATAAGAAA |
Barcode Sequence | ATTACTTATACGGAA |
Form | Liquid |
UNIPROT ID | Q15762 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD226 (DNAM-1) is a ~65 kDa glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. CD226 mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Interactions of CD226 and its ligands, CD155 and CD112, induce NK and T cell-mediated cytotoxicity and cytokine secretion (PMID: 15039383).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |