MultiPro® 5CFLX Anti-Human CD27 (1C1G3)

• 

  Single Cell Sequencing experiment G66308-1-5C on Resting PBMC

  G66308-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66308-1-5C on PBMC treated with 4hr LPS + TI

  G66308-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G66308-1-5C on Resting PBMC

  G66308-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G66308-1-5C on PBMC treated with 4hr LPS + TI

  G66308-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD27 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G66308-1-5C

Clone No.1C1G3

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD27, CD27 antigen, CD27 molecule, CD27L receptor, S152, T cell activation antigen CD27, T14, TNFRSF7, Tp55

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66308-1-5C targets CD27 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  CatNo: Ag24537

  Product name: Recombinant human CD27 protein

  Source: e coli.-derived, PET30a

  Tag: 6*His

  Domain: 1-260 aa of BC012160

  Sequence: MARPHPWWLCVLGTLVGLSATPAPKSCPERHYWAQGKLCCQMCEPGTFLVKDCDQHRKAAQCDPCIPGVSFSPDHHTRPHCESCRHCNSGLLVRNCTITANAECACRNGWQCRDKECTECDPLPNPSLTARSSQALSPHPQPTHLPYVSEMLEARTAGHMQTLADFRQLPARTLSTHWPPQRSLCSSDFIRILVIFSGMFLVFTLAGALFLHQRRKYRSNKGESPVEPAEPCRYSCPREEEGSTIPIQEDYRKPEPACSP

• Full Name: MultiPro® 5CFLX Anti-Human CD27 (1C1G3)
• Calculated Molecular Weight: 29 kDa
• GenBank Accession Number: BC012160
• Gene Symbol: CD27
• Gene ID (NCBI): 939
• ENSEMBL Gene ID: ENSG00000139193
• RRID: AB_3673946
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGTGAGCGCAATCAGCCCATATAAGAAA
• Barcode Sequence: TGTGAGCGCAATCAG
• Form: Liquid
• UNIPROT ID: P26842
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD27 (also known as TNFRSF7) is a type I glycoprotein expressed on some B cells and the majority of T cells, and is a member of the tumor necrosis factor (TNF) receptor family. CD27 is required for generation and long-term maintenance of T cell immunity (PMID: 11062504). It is a receptor for CD70 (CD27L). Ligation of CD27 by CD70 induces strong ubiquitination of TRAF and the activation of both canonical and non-canonical NF-kappaB pathways, as well as the JNK pathway (PMID: 19426224). CD27 may also play a role in apoptosis through association with SIVA1.