Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G65103-1-5C targets CD40 in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Mouse / IgG1, kappa |
| Class | Oligo Conjugate |
| Type | Monoclonal |
| Immunogen |
N/A Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human CD40 (G28.5) |
| Calculated Molecular Weight | 277 aa, 31 kDa |
| GenBank Accession Number | BC012419 |
| Gene Symbol | CD40 |
| Gene ID (NCBI) | 958 |
| ENSEMBL Gene ID | ENSG00000101017 |
| RRID | AB_3673913 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGATTGCTATGACGTACCCCATATAAGAAA |
| Barcode Sequence | ATTGCTATGACGTAC |
| Form | Liquid |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD40, also named as TNFRSF5 and Bp50, is a type I transmembrane protein that belongs to the tumor necrosis factor-R (TNF-R) family (PMID: 10647992). CD40 is expressed on B cells, dendritic cells (DCs), monocytes, platelets, and macrophages as well as by non-hematopoietic cells such as myofibroblasts, fibroblasts, epithelial, and endothelial cells (PMID: 19426221). It is a receptor for TNFSF5/CD40LG. CD40L/CD40 interactions are essential for immunoglobulin (Ig) isotype switching, germinal center formation and the development of B cell memory (PMID: 7516405; 11675497).
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |



