MultiPro® 5CFLX Anti-Human CD8 (SK1)

CD8 Monoclonal Antibody for Single Cell (Intra)
Cat No. G65146-1-5C
Clone No.SK1

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

CD8, CD8A, CD8a molecule, Leu2, MAL, p32, SK1

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65146-1-5C targets CD8 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen N/A Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD8 (SK1)
Calculated Molecular Weight 235 aa, 26 kDa
GenBank Accession NumberBC025715
Gene Symbol CD8A
Gene ID (NCBI) 925
ENSEMBL Gene IDENSG00000153563
RRIDAB_3673920
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGATTAGATTGGTTAACCCCATATAAGAAA
Barcode SequenceATTAGATTGGTTAAC
Form Liquid
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD8 is a transmembrane glycoprotein composed of two disulfide-linked chains. It can be present as a homodimer of CD8α or as a heterodimer of CD8α and CD8β (PMID: 3264320; 8253791). CD8 is found on most thymocytes. The majority of class I-restricted T cells express mostly the CD8αβ heterodimer while CD8αα homodimers alone have been found on some gut intraepithelial T cells , on some T cell receptor (TCR) γδ T cells and on NK cells (PMID: 2111591; 1831127; 8420975). CD8 acts as a co-receptor that binds to MHC class-I and participates in cytotoxic T cell activation (PMID: 8499079). During T cell development, CD8 is required for positive selection of CD4-/CD8+ T cells (PMID: 1968084).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...