MultiPro® 5CFLX Anti-Human CD8 (SK1)

• 

  Single Cell Sequencing experiment G65146-1-5C on Resting PBMC

  G65146-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65146-1-5C on PBMC treated with 4hr LPS + TI

  G65146-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

CD8 Monoclonal Antibody for Single Cell (Intra)

Cat No. G65146-1-5C

Clone No.SK1

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CD8, CD8A, CD8a molecule, Leu2, MAL, p32, SK1

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65146-1-5C targets CD8 in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  N/A

• Full Name: MultiPro® 5CFLX Anti-Human CD8 (SK1)
• Calculated Molecular Weight: 235 aa, 26 kDa
• GenBank Accession Number: BC025715
• Gene Symbol: CD8A
• Gene ID (NCBI): 925
• ENSEMBL Gene ID: ENSG00000153563
• RRID: AB_3673920
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTAGATTGGTTAACCCCATATAAGAAA
• Barcode Sequence: ATTAGATTGGTTAAC
• Form: Liquid
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD8 is a transmembrane glycoprotein composed of two disulfide-linked chains. It can be present as a homodimer of CD8α or as a heterodimer of CD8α and CD8β (PMID: 3264320; 8253791). CD8 is found on most thymocytes. The majority of class I-restricted T cells express mostly the CD8αβ heterodimer while CD8αα homodimers alone have been found on some gut intraepithelial T cells , on some T cell receptor (TCR) γδ T cells and on NK cells (PMID: 2111591; 1831127; 8420975). CD8 acts as a co-receptor that binds to MHC class-I and participates in cytotoxic T cell activation (PMID: 8499079). During T cell development, CD8 is required for positive selection of CD4-/CD8+ T cells (PMID: 1968084).