MultiPro® 5CFLX Anti-Human Lamin A/C (5I16)

Lamin A/C Recombinant Antibody for Single Cell (Intra)
Cat No. G81042-1-5C
Clone No.5I16

Host / Isotype

Rabbit / IgG

Reactivity

Human

Applications

Single Cell (Intra)

70 kDa lamin, CDCD1, CDDC, CMD1A, CMT2B1, EMD2, FPL, FPLD, HGPS, IDC, lamin A, lamin A/C, LDP1, LFP, LGMD1B, LMN1, LMNA, LMNC, Prelamin A/C, PRO1

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G81042-1-5C targets Lamin A/C in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Rabbit / IgG
Class Oligo Conjugate
Type Recombinant
Immunogen Lamin A/C fusion protein Ag0408 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human Lamin A/C (5I16)
Calculated Molecular Weight 65 kDa
GenBank Accession NumberBC003162
Gene Symbol Lamin A/C
Gene ID (NCBI) 4000
ENSEMBL Gene IDENSG00000160789
RRIDAB_3673977
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGAAGTGGAGTGTGTCTCCCATATAAGAAA
Barcode SequenceAAGTGGAGTGTGTCT
Form Liquid
UNIPROT IDP02545
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Lamin A/C is also named as LMNA, or LMN1. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. The lack of lamin A/C can be as a novel marker for undifferentiated embryonic stem cells and lamin A/C expression is as an early indicator of differentiation (PMID: 16179429). Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. This protein has 4 isoforms produced by alternative splicing with the molecular weight of 74 kDa, 65 kDa, 70 kDa and 64 kDa. This antibody can recognize 4 isoforms of Lamin A/C.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...