Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G66618-2-5C targets SPI1 in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Mouse / IgG1 |
| Class | Oligo Conjugate |
| Type | Monoclonal |
| Immunogen |
Peptide Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human SPI1 (2H3D3) |
| Calculated Molecular Weight | 31 kDa |
| GenBank Accession Number | NM_003120 |
| Gene Symbol | SPI1 |
| Gene ID (NCBI) | 6688 |
| ENSEMBL Gene ID | ENSG00000066336 |
| RRID | AB_3673957 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGGCAATAACCTCCGCGCCCATATAAGAAA |
| Barcode Sequence | GCAATAACCTCCGCG |
| Form | Liquid |
| UNIPROT ID | P17947 |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
SPI1, also named as 31 kDa-transforming protein, is a 270 amino acid protein, which belongs to the ETS family. SPI1 is highly expressed in both FV-P and FV-A-induced erythro-leukemia cell lines that have undergone rearrangements of the SPI1 gene due to the insertion of SFFV.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |



