Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Positive Single Cell detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
SINGLE CELL | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65086-1-5C targets CD11c in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen |
fusion protein Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD11c (3.9) |
Calculated Molecular Weight | 1169 aa, 129 kDa |
GenBank Accession Number | BC038237 |
Gene Symbol | CD11c |
Gene ID (NCBI) | 3687 |
ENSEMBL Gene ID | ENSG00000140678 |
RRID | AB_3673910 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGAAGCAATACTTATACCCCATATAAGAAA |
Barcode Sequence | AAGCAATACTTATAC |
Form | Liquid |
UNIPROT ID | P20702 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Integrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11c, also known as integrin αX, is a type I transmembrane glycoprotein present on a variety of cells, including monocytes/macrophages, granulocytes, a subset of B cells, NK cells and dendritic cells (PMID: 2897326; 1680915; 1694698; 17389580). As a result of its high level of expression on most dendritic cells, CD11c is typically considered to be a marker of conventional dendritic cells (PMID: 27119555). CD11c forms an α/β heterodimer with CD18 (integrin β2). CD11c/CD18 acts a receptor for fibrinogen and is important in monocyte adhesion and chemotaxis (PMID: 1671533).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |