MultiPro® 5CFLX Anti-Human CD14 (UCHM-1)

• 

  Single Cell Sequencing experiment G65056-1-5C on Resting PBMC

  G65056-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65056-1-5C on PBMC treated with 4hr LPS + TI

  G65056-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD14 Monoclonal Antibody for Single Cell

Cat No. G65056-1-5C

Clone No.UCHM-1

Host / Isotype

Mouse / IgG2a

Reactivity

Human

Applications

Single Cell

Synonyms

CD14, CD14 molecule

---

Tested Applications

• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65056-1-5C targets CD14 in Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG2a
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  Thymocytes and peripheral blood lymphocytes from a remission AML patient

• Full Name: MultiPro® 5CFLX Anti-Human CD14 (UCHM-1)
• Calculated Molecular Weight: 375 aa, 40 kDa
• GenBank Accession Number: BC010507
• Gene Symbol: CD14
• Gene ID (NCBI): 929
• ENSEMBL Gene ID: ENSG00000170458
• RRID: AB_3673906
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTTGCGTCTACCGCCCCCATATAAGAAA
• Barcode Sequence: CTTGCGTCTACCGCC
• Form: Liquid
• UNIPROT ID: P08571
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD14 is a 50-55 kDa glycosylphosphatidylinositol-anchored glycoprotein preferentially expressed on monocytes and macrophages, and at lower levels on granulocytes (PMID: 3385210; 2462937; 7685797). CD14 can also exist as a soluble protein. CD14 acts as a co-receptor for bacterial liposaccharides (LPS) (PMID: 1698311). It plays a major role in the inflammatory response of monocytes to LPS.