Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. | 
Recommended dilution
| Application | Dilution | 
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test | 
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G65169-1-5C targets CD163 in Single Cell (Intra) applications and shows reactivity with Human samples.
| Tested Reactivity | Human | 
| Host / Isotype | Mouse / IgG1, kappa | 
| Class | Oligo Conjugate | 
| Type | Monoclonal | 
| Immunogen | 
                                             Glycoprotein preparation from hairy cell leukemia spleen Predict reactive species | 
                                    
| Full Name | MultiPro® 5CFLX Anti-Human CD163 (GHI/61) | 
| Calculated Molecular Weight | 1156 aa, 125 kDa | 
| GenBank Accession Number | BC051281 | 
| Gene Symbol | CD163 | 
| Gene ID (NCBI) | 9332 | 
| ENSEMBL Gene ID | ENSG00000177575 | 
| RRID | AB_3673925 | 
| Conjugate | 5CFLX | 
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGACCGCGACCTGATAACCCATATAAGAAA | 
| Barcode Sequence | ACCGCGACCTGATAA | 
| Form | Liquid | 
| UNIPROT ID | Q86VB7 | 
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. | 
| Storage Conditions | 2-8°C Stable for one year after shipment. | 
Background Information
CD163, also known as M130, is a membrane glycoprotein which belongs to the scavenger receptor superfamily (PMID: 8370408). It is an acute phase-regulated and signal-inducing macrophage protein expressed exclusively in monocytes and tissue macrophages (PMID: 11196644). CD163 mediates endocytosis of haptoglobin-haemoglobin complexes (PMID: 11196644). The uptake of haptoglobin by macrophages contributes to the recycling of iron and also to the inflammatory response (PMID: 22900885). Soluble CD163 (sCD163), as a result of ectodomain shedding during inflammatory activation of macrophages, circulates in blood and has been suggested as a plasma/serum marker for macrophage activity (PMID: 12570164).
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol | 
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol | 



