Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65169-1-5C targets CD163 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen |
fusion protein Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD163 (GHI/61) |
Calculated Molecular Weight | 1156 aa, 125 kDa |
GenBank Accession Number | BC051281 |
Gene Symbol | CD163 |
Gene ID (NCBI) | 9332 |
ENSEMBL Gene ID | ENSG00000177575 |
RRID | AB_3673925 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGACCGCGACCTGATAACCCATATAAGAAA |
Barcode Sequence | ACCGCGACCTGATAA |
Form | Liquid |
UNIPROT ID | Q86VB7 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD163, also known as M130, is a membrane glycoprotein which belongs to the scavenger receptor superfamily (PMID: 8370408). It is an acute phase-regulated and signal-inducing macrophage protein expressed exclusively in monocytes and tissue macrophages (PMID: 11196644). CD163 mediates endocytosis of haptoglobin-haemoglobin complexes (PMID: 11196644). The uptake of haptoglobin by macrophages contributes to the recycling of iron and also to the inflammatory response (PMID: 22900885). Soluble CD163 (sCD163), as a result of ectodomain shedding during inflammatory activation of macrophages, circulates in blood and has been suggested as a plasma/serum marker for macrophage activity (PMID: 12570164).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |