MultiPro® 5CFLX Anti-Human CD18 (TS1/18)

• 

  Single Cell Sequencing experiment G65190-1-5C on Resting PBMC

  G65190-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65190-1-5C on PBMC treated with 4hr LPS + TI

  G65190-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65190-1-5C on Resting PBMC

  G65190-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65190-1-5C on PBMC treated with 4hr LPS + TI

  G65190-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD18 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65190-1-5C

Clone No.TS1/18

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD18, Integrin beta 2, ITGB2, LAD, LCAMB, LFA 1, MAC 1, MF17, MFI7

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65190-1-5C targets CD18 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  fusion protein

• Full Name: MultiPro® 5CFLX Anti-Human CD18 (TS1/18)
• Calculated Molecular Weight: 85 kDa
• GenBank Accession Number: BC005861
• Gene Symbol: CD18
• Gene ID (NCBI): 3689
• ENSEMBL Gene ID: ENSG00000160255
• RRID: AB_3673928
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGTGGTTGGAAGCACCCCATATAAGAAA
• Barcode Sequence: CGTGGTTGGAAGCAC
• Form: Liquid
• UNIPROT ID: P05107
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD18, also known as integrin beta-2, is a transmembrane protein that forms heterodimers with CD11a, CD11b, CD11c, CD11d (PMID: 1968349). CD11a/CD18 (LFA-1) is expressed by all leukocytes, while CD11b/CD18 (Mac-1) and CD11c/CD18 (p150,95) are normally restricted to expression on monocytes, macrophages, polymorphonuclear lymphocytes (PMNs), and natural killer cells (PMID: 1968349; 3109455; 10946284). CD18 plays an important role in mediating cell adhesion during immune response and defects of CD18 cause leukocyte adhesion deficiency (PMID: 3594570).