MultiPro® 5CFLX Anti-Human CD19 (HIB19)

CD19 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65110-1-5C
Clone No.HIB19

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

B lymphocyte antigen CD19, B4, CD19, CD19 molecule, Differentiation antigen CD19, T cell surface antigen Leu 12

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65110-1-5C targets CD19 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen

fusion protein

Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD19 (HIB19)
Calculated Molecular Weight 556 aa, 61 kDa
GenBank Accession NumberBC006338
Gene Symbol CD19
Gene ID (NCBI) 930
ENSEMBL Gene IDENSG00000177455
RRIDAB_3673915
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGCGGCTGGTCCTTCATCCCATATAAGAAA
Barcode SequenceCGGCTGGTCCTTCAT
FormLiquid
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD19 is a 95 kDa type I transmembrane glycoprotein belonging to the immunoglobulin superfamily (PMID: 2472450). It is expressed by B cells and follicular dendritic cells. CD19 is up-regulated at the step of B-lineage commitment during the differentiation of the hematopoietic stem cell, it remains on during subsequent stages of differentiation until finally down-regulated during terminal differentiation into plasma cells (PMID: 8528044). CD19 is involved in B cell development, activation and differentiation. It is the dominant component for the signaling complex on B cells that includes CD21 (CR2), CD81 (TAPA-1) and CD225 and acts as a critical co-receptor for BCR signal transduction (PMID: 23210908).

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...
||
New chat Able
正在加载,请稍候...