MultiPro® 5CFLX Anti-Human CD35 (E11)

CD35 Monoclonal Antibody for Single Cell (Intra), Single Cell
Cat No. G65254-1-5C
Clone No.E11

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

C3b/C4b receptor, C3BR, CD35, Complement receptor type 1, CR1, KN

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  {{ptg:cur_Conjugation}}
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
Positive Single Cell detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
SINGLE CELL<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65254-1-5C targets CD35 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1, kappa
Class Oligo Conjugate
Type Monoclonal
Immunogen Human CD35 from Acute monocytic leukemia cells and normal blood monocytes Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human CD35 (E11)
Calculated Molecular Weight 224 kDa
GenBank Accession NumberNM_000573
Gene Symbol CR1
Gene ID (NCBI) 1378
ENSEMBL Gene IDENSG00000203710
RRIDAB_3673940
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGAATGAATTGGATTCGCCCATATAAGAAA
Barcode SequenceAATGAATTGGATTCG
Form Liquid
UNIPROT IDP17927
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

CD35, also known as complement receptor type 1 (CR1) or C3b/C4b receptor, is a single-chain glycoprotein consisting of 30 repeating homologous protein domains known as short consensus repeats (~60 amino acids each) followed by transmembrane and cytoplasmic domains (PMID: 8765013). CD35 is variably expressed by granulocytes, monocytes, B cells, some T cells, erythrocytes, follicular dendritic cells, Langerhans cells, and glomerular podocytes (PMID: 19004497). CD35 acts as a receptor for C3b and C4b and plays important roles in the regulation of the complement cascade and clearance of immune complexes.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...