Tested Applications
| Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
| Positive Single Cell detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
| Application | Dilution |
|---|---|
| SINGLE CELL (INTRA) | <0.5ug/test |
| SINGLE CELL | <0.5ug/test |
| It is recommended that this reagent should be titrated in each testing system to obtain optimal results. | |
Product Information
G65254-1-5C targets CD35 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.
| Tested Reactivity | Human |
| Host / Isotype | Mouse / IgG1, kappa |
| Class | Oligo Conjugate |
| Type | Monoclonal |
| Immunogen |
Human CD35 from Acute monocytic leukemia cells and normal blood monocytes Predict reactive species |
| Full Name | MultiPro® 5CFLX Anti-Human CD35 (E11) |
| Calculated Molecular Weight | 224 kDa |
| GenBank Accession Number | NM_000573 |
| Gene Symbol | CR1 |
| Gene ID (NCBI) | 1378 |
| ENSEMBL Gene ID | ENSG00000203710 |
| RRID | AB_3673940 |
| Conjugate | 5CFLX |
| Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGAATGAATTGGATTCGCCCATATAAGAAA |
| Barcode Sequence | AATGAATTGGATTCG |
| Form | Liquid |
| UNIPROT ID | P17927 |
| Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
| Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
CD35, also known as complement receptor type 1 (CR1) or C3b/C4b receptor, is a single-chain glycoprotein consisting of 30 repeating homologous protein domains known as short consensus repeats (~60 amino acids each) followed by transmembrane and cytoplasmic domains (PMID: 8765013). CD35 is variably expressed by granulocytes, monocytes, B cells, some T cells, erythrocytes, follicular dendritic cells, Langerhans cells, and glomerular podocytes (PMID: 19004497). CD35 acts as a receptor for C3b and C4b and plays important roles in the regulation of the complement cascade and clearance of immune complexes.
Protocols
| MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
| 10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |







