Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G65075-1-5C targets CD54 (ICAM-1) in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Mouse / IgG1, kappa |
Class | Oligo Conjugate |
Type | Monoclonal |
Immunogen | Rheumatoid synovial cells and human monocytes Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CD54/ICAM-1 (15.2) |
Calculated Molecular Weight | 90 kDa |
GenBank Accession Number | BC015969 |
Gene Symbol | ICAM-1 |
Gene ID (NCBI) | 3383 |
ENSEMBL Gene ID | ENSG00000090339 |
RRID | AB_3673909 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGAGTGTTGTGGAGATCCCCATATAAGAAA |
Barcode Sequence | AGTGTTGTGGAGATC |
Form | Liquid |
UNIPROT ID | P05362 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
ICAM-1 (CD54) is a 90-kDa transmembrane glycoprotein of the immunoglobulin superfamily and is critical for the firm attachment and transmigration of leukocytes out of blood vessels and into tissues (PMID: 19307690). ICAM-1 is expressed by several cell types, typically on endothelial cells and cells of the immune system, and its expression can be up-regulated by various stimuli, including TNF-α, INF-γ, IL-1 and thrombin (PMID: 3086451; 9694714; 15979056). It is a ligand for LFA-1 and Mac-1, serves as a receptor for rhinovirus, and is one of several receptors used by Plasmodium falciparum (PMID: 2566624; 2538244; 2475784).
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |