Tested Applications
Positive Single Cell (Intra) detected in | 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. |
Recommended dilution
Application | Dilution |
---|---|
SINGLE CELL (INTRA) | <0.5ug/test |
It is recommended that this reagent should be titrated in each testing system to obtain optimal results. |
Product Information
G17038-1-5C targets CXCL8/IL-8 in Single Cell (Intra) applications and shows reactivity with Human samples.
Tested Reactivity | Human |
Host / Isotype | Rabbit / IgG |
Class | Oligo Conjugate |
Type | Polyclonal |
Immunogen |
CatNo: Ag10552 Product name: Recombinant human CXCL8/IL-8 protein Source: e coli.-derived, PGEX-4T Tag: GST Domain: 1-99 aa of BC013615 Sequence: MTSKLAVALLAAFLISAALCEGAVLPRSAKELRCQCIKTYSKPFHPKFIKELRVIESGPHCANTEIIVKLSDGRELCLDPKENWVQRVVEKFLKRAENS Predict reactive species |
Full Name | MultiPro® 5CFLX Anti-Human CXCL8/IL-8 (Polyclonal) |
Calculated Molecular Weight | 99 aa, 11 kDa |
GenBank Accession Number | BC013615 |
Gene Symbol | IL-8 |
Gene ID (NCBI) | 3576 |
ENSEMBL Gene ID | ENSG00000169429 |
RRID | AB_3673891 |
Conjugate | 5CFLX |
Full Oligo Sequence | CGGAGATGTGTATAAGAGACAGCGAGCTGAATAATGGCCCATATAAGAAA |
Barcode Sequence | CGAGCTGAATAATGG |
Form | Liquid |
UNIPROT ID | P10145 |
Storage Buffer | PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. |
Storage Conditions | 2-8°C Stable for one year after shipment. |
Background Information
Interleukin 8 (IL-8), also known as CXCL8, which is a member of the CXC chemokine family. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli. IL-8 has two primary functions. It induces chemotaxis in target cells, primarily neutrophils but also other granulocytes, causing them to migrate toward the site of infection. IL-8 also induces phagocytosis once they have arrived. This gene is believed to play a role in the pathogenesis of bronchiolitis, a common respiratory tract disease caused by viral infection. IL-8 is also known to be a potent promoter of angiogenesis. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.
Protocols
MultiPro™ Cell Surface and Intracellular Staining Protocol | Download protocol |
10x Genomics Cell Surface Protein Only Staining Protocol | Download protocol |