MultiPro® 5CFLX Anti-Human IL-17A (1F3E3)

• 

  Single Cell Sequencing experiment G69021-1-5C on Resting PBMC

  G69021-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G69021-1-5C on PBMC treated with 4hr LPS + TI

  G69021-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G69001-1-5C on PBMC treated with 4hr PMA + TI

  G69021-1-5C was used to stain PBMC under 4hr PMA + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

NeutraKine® IL-17A Monoclonal Antibody for Single Cell (Intra)

Cat No. G69021-1-5C

Clone No.1F3E3

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

Synonyms

CTLA 8, CTLA8, IL 17, IL 17A, IL17, IL-17, IL17A, IL-17A, interleukin 17A, NeutraKine® IL-17A

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G69021-1-5C targets NeutraKine® IL-17A in Single Cell (Intra) applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  RecombinantProtein

• Full Name: MultiPro® 5CFLX Anti-Human IL-17A (1F3E3)
• Gene Symbol: IL-17A
• Gene ID (NCBI): 3605
• ENSEMBL Gene ID: ENSG00000112115
• RRID: AB_3673974
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTAGCGCTACCTAACCCCATATAAGAAA
• Barcode Sequence: CTAGCGCTACCTAAC
• Form: Liquid
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

IL17A, also named as IL-17, is a proinflammatory cytokine. IL-17, synthesized only by memory T cells and natural killer cells, has pleiotropic effects, mainly in the recruitment and activation of neutrophils. This cytokine regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. The IL-17 receptor is a type I transmembrane protein, that is widely expressed on epithelial cells, fibroblasts, B and T cells, and monocytic cells. In psoriatic skin lesions, both Th17 cells and their downstream effector molecules, e.g. IL-17 and IL-22, are highly increased.

This antibody can be used to neutralize the bioactivity of IL-17A.