MultiPro® 5CFLX Anti-Human Lamin B1 (3C10G12)

Lamin B1 Monoclonal Antibody for Single Cell (Intra)

Cat No. G66095-1-5C
Clone No.3C10G12

Host / Isotype

Mouse / IgG1

Reactivity

Human

Applications

Single Cell (Intra)

ADLD, lamin B1, LMN, LMN2, LMNB, LMNB1

Formulation:  PBS and Azide
PBS and Azide
Conjugate:  5CFLX
Size/Concentration: 

-/ -

Freight/Packing: -

Quantity

Please visit your regions distributor:


Tested Applications

Positive Single Cell (Intra) detected in10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

ApplicationDilution
SINGLE CELL (INTRA)<0.5ug/test
It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G66095-1-5C targets Lamin B1 in Single Cell (Intra) applications and shows reactivity with Human samples.

Tested Reactivity Human
Host / Isotype Mouse / IgG1
Class Oligo Conjugate
Type Monoclonal
Immunogen Lamin B1 fusion protein Ag20522 Predict reactive species
Full Name MultiPro® 5CFLX Anti-Human Lamin B1 (3C10G12)
Calculated Molecular Weight 66 kDa
GenBank Accession NumberBC012295
Gene Symbol Lamin B1
Gene ID (NCBI) 4001
ENSEMBL Gene IDENSG00000113368
RRIDAB_3673943
Conjugate 5CFLX
Full Oligo SequenceCGGAGATGTGTATAAGAGACAGTCGTACTATACTAACCCCATATAAGAAA
Barcode SequenceTCGTACTATACTAAC
Form Liquid
UNIPROT IDP20700
Storage Buffer PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
Storage Conditions2-8°C Stable for one year after shipment.

Background Information

Lamins are components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner nuclear membrane, which is thought to provide a framework for the nuclear envelope and may also interact with chromatin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Vertebrate lamins consist of two types, A and B. This gene encodes one of the two B type proteins, B1. This protein is not suitable for samples where the nuclear envelope has been removed.

Protocols

MultiPro™ Cell Surface and Intracellular Staining ProtocolDownload protocol
10x Genomics Cell Surface Protein Only Staining ProtocolDownload protocol
Loading...