MultiPro® 5CFLX Anti-Human CD5 (UCHT2)

• 

  Single Cell Sequencing experiment G65152-1-5C on Resting PBMC

  G65152-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65152-1-5C on PBMC treated with 4hr LPS + TI

  G65152-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Fix-Stain protocol.

• 

  Single Cell Sequencing experiment G65152-1-5C on Resting PBMC

  G65152-1-5C was used to stain Resting PBMC and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

• 

  Single Cell Sequencing experiment G65152-1-5C on PBMC treated with 4hr LPS + TI

  G65152-1-5C was used to stain PBMC under 4hr LPS + TI treatment and analyzed with 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing kit with Stain-Fix protocol.

CD5 Monoclonal Antibody for Single Cell (Intra), Single Cell

Cat No. G65152-1-5C

Clone No.UCHT2

Host / Isotype

Mouse / IgG1, kappa

Reactivity

Human

Applications

Single Cell (Intra), Single Cell

Synonyms

CD5, CD5 molecule, LEU1, Lymphocyte antigen T1/Leu 1, T1

---

Tested Applications

• Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.
• Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product.

Recommended dilution

• SINGLE CELL (INTRA): <0.5ug/test
• SINGLE CELL: <0.5ug/test

It is recommended that this reagent should be titrated in each testing system to obtain optimal results.

Product Information

G65152-1-5C targets CD5 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples.

• Tested Reactivity: Human
• Host / Isotype: Mouse / IgG1, kappa
• Class: Oligo Conjugate
• Type: Monoclonal
• Immunogen:

  N/A

• Full Name: MultiPro® 5CFLX Anti-Human CD5 (UCHT2)
• Calculated Molecular Weight: 495 aa, 55 kDa
• GenBank Accession Number: BC027901
• Gene Symbol: CD5
• Gene ID (NCBI): 921
• ENSEMBL Gene ID: ENSG00000110448
• RRID: AB_3673921
• Conjugate: 5CFLX
• Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGCCTCGCATTGCACCCATATAAGAAA
• Barcode Sequence: GTGCCTCGCATTGCA
• Form: Liquid
• Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3.
• Storage Conditions: 2-8°C Stable for one year after shipment.

Background Information

CD5 is a type I transmembrane glycoprotein of the scavenger receptor cysteine-rich family (PMID: 12403363). CD5 is expressed on a majority of thymocytes, mature T cells, B cell subsets, and peripheral blood dendritic cells (PMID: 9858516; 6156984; 10379049; 1384337). CD5 may act as a receptor in regulating T-cell proliferation. It functions as a negative regulator of TCR signaling during thymocyte development (PMID: 7542801).